Proteins

They are kind of important

1/14/2025

print view

%%html
<script src="https://bits.csb.pitt.edu/preamble.js"></script>

MSCBIO2030: Introduction to Computational Structural Biology

...biomolecular structure, statistical mechanical phenomenon in biophysics, simulation of biomolecular behavior, and key applications of computations in the field of structural biology. Specific topics: probability theory, statistical mechanics and thermodynamics, simulation methods, electrostatic phenomena, biochemical kinetics, binding, coarse-grained modeling, enhanced sampling, free energy calculations, protein structure prediction, and structure-based drug design.

Life is basically atoms interacting with one another, so we're going to study that.

Instructor

David Koes
dkoes@pitt.edu
Office: Murdoch 748
Office Hours: 3pm Friday (after recitation) and by appointment

TA

Alex Goldberg
amg535@pitt.edu
Office Hours: ?

Emma Flynn
7th Floor Murdoch Building
Office Hours: ?
ELF152@pitt.edu

%%html
<div id="dogpref" style="width: 500px"></div>
<script>
    var divid = '#dogpref';
	jQuery(divid).asker({
	    id: divid,
	    question: "How to you feel about dogs?",
		answers: ["Love them","Like them",'Neutral',"Want to avoid"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Logistics

• Lectures 2:30-4:00pm on Tuesdays and Thursdays in Murdoch 814.

• Building Access Email Kelly Gentille (kmg120@pitt.edu) with picture of front and back of id card.

• Recitations 2pm on Friday. Average recitation length should be ~1 hour but will stick around to 4pm.

• Course material will be posted to Canvas: https://canvas.pitt.edu/courses/301742

• Slack will be used for group discussions, announcements, and contacting staff. https://compstruct.slack.com/

• Panopto All classes are automatically recorded and are available on Panopto as linked from Canvas. Recordings are provided as a study aid, not a replacement for attending class.

• Zoom is available as a fallback when in-person attendance is not possible (linked from Canvas).

Assignments

• Planning on seven assignments and a project
• A mix of programming (Python) and free response.
• Students work individually on assignments
  • Do discuss general concepts, strategies for debugging, and the particulars of a specific software package.
  • Do not show your code to fellow classmates.

Lateness

• Max two late days per assignment
• Max five total late days
• Late assignments have maximum score of 95%
• Additional late day requests require substantial justification

Books

No required books, but several are available for reference.

• Z: Zuckerman. Statistical Physics of Biomolecules
• BJD: Bahar, Jernigan, Dill. Protein Actions: Principles & Modeling
• CELL: Phillips, Kondev, Theriot, Garcia, Orme. Physical Biology of the Cell, 2nd Edition
• LIFE: Kuriyan, Konforti, Wemmer. The Molecules of Life
• DILL: Dill, Bromberg. Molecular Driving Forces: Statistical Thermodynamics in Biology, Chemistry, Physics, and Nanoscience
• KB: Kessel, Ben-tal. Introduction to Proteins: Structure, Function, and Motion
• FE: Chipot, Pohorille. Free Energy Calculations
• SIM: Frenkel and Smith. Understanding Molecular Simulation: From Algorithms to Applications
• PMLS2: Nelson: Physical Models of Living Systems 2nd Edition

Grades

• 55% Assignments
• 10% Recitation (checks)
• 10% Quizzes
• 10% Journal Club
• 15% Project

Final Grade Targets

• A+ 97–100%
• A 93–96%
• A− 90–92%
• B+ 87–89%
• B 83–86%
• B− 80–82%

We reserve the right to modify grade distributions and cutoffs to most accurately reflect student performance.

Any questions on course mechanics?

Central Dogma

DNA Sequence $\rightarrow$ RNA $\rightarrow$ Protein $\rightarrow$ Structure (Dynamics) $\rightarrow$ Function

import py3Dmol

DNA Structure

Where is major/minor groove?

v = py3Dmol.view('4c64',style='cartoon'); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Molecular Representations

Cartoons trace molecule and show key features.

v = py3Dmol.view('4c64',style='cartoon'); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Molecular Representations

Spheres (space-filling) highlights individual atoms (usually color coded by element).

v = py3Dmol.view('4c64',style='sphere'); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Molecular Representations

Sticks (licorice) highlights bonds. Often used for small molecules.

v = py3Dmol.view('4c64',style='stick'); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Note that sticks and cartoon won't show nonbonded atoms...

v = py3Dmol.view('4c64',style='stick')
v.setStyle({'bonds':0},{'sphere':{'radius':0.5}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

%%html
<div id="whatdots" style="width: 500px"></div>
<script>
    var divid = '#whatdots';
	jQuery(divid).asker({
	    id: divid,
	    question: "What are the red dots?",
		answers: ["Water","Ions","Cofactors","Phosphates"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Molecular Representations

Surfaces show the overall shape.

v = py3Dmol.view('4c64',style='stick')
v.addSurface()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

<py3Dmol.view at 0x120b74b20>

Molecular Surfaces

From Introduction to Proteins: Structure, Function, and Motion. Amit Kessel & Nir Ben-Tal

Molecular Surfaces

v = py3Dmol.view('4c64',width=770,viewergrid=(1,3))
v.addSurface('VDW',viewer=(0,0)); v.addSurface('MS',viewer=(0,1)); v.addSurface('SAS',viewer=(0,2)); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

RNA Can Have Interesting Structure

S-adenosylmethionine (SAM) / S-adenosylhomocysteine (SAH) riboswitch - regulates transcription of SAM-biosynthetic enzymes.

v = py3Dmol.view(query='6HAG',style='cartoon')
v.setStyle({'resn':'SAH'},'sphere')

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

<py3Dmol.view at 0x120bb2a00>

RNA Can Have Interesting Structure

Transfer RNA

py3Dmol.view(query='4tna',style='stick')

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

<py3Dmol.view at 0x120bb27f0>

...But We're Just Going To Focus on Proteins

Proteins are important

• About half of dry mass of a cell
• Perform most of the cell's functions: transcription, signaling, catalysis, transport, molecular recognition, mechanical support, motion...

v = py3Dmol.view(query='3WTG',style={'cartoon':{'colorscheme':'chain'}})
v.setStyle({'resn':'HEM'},'stick')

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

<py3Dmol.view at 0x120bb2a90>

Proteins are polymers (chains) of amino acids

GATTACAGATTACAGATTACA $\rightarrow$ (N-terminal) DYRLQIT (C-terminal)

After forming the peptide bond, amino acids are called residues.

You need to know the 20 amino acids

v = py3Dmol.view(query='cid:5950',style={'stick':{},'sphere':{'radius':0.5}})
v.addLabel('C⍺',{'backgroundOpacity':.8},{'index':3});v.addLabel('N-terminal',{'backgroundOpacity':.8},{'index':10}); v.addLabel('C-terminal',{'backgroundOpacity':.8},{'index':5}); v.addLabel('Side-chain',{'backgroundOpacity':.8},{'index':8}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

%%html
<div id="whataa" style="width: 500px"></div>
<script>
    var divid = '#whataa';
	jQuery(divid).asker({
	    id: divid,
	    question: "What is the previous amino acid?",
		answers: ["alanine","asparigine",'glycine',"None of the above"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

A Bit of Biochemistry

Carboxylic acid (carboxyl group)

Acidic: wants to lose a proton (hydrogen)

Amino group (primary amine)

Basic: wants to gain a proton

pKa

Inverse measure of acid strength (lower number = stronger acid; opposite of Ka)

$$pK_a = -\log(K_a)$$$$K_a = \frac{[R^-][H^+]}{[RH]}$$$$pH = -\log([H^+]) = pK_a + \log\frac{[R^-]}{[RH]}$$

pKa

$$pH = pK_a + \log\frac{[R^-]}{[RH]}$$

• $pH > pK_a \rightarrow [R^-] > [RH]$ acid mostly deprotonated (hydrogen isn't there)
• $pH < pK_a \rightarrow [R^-] < [RH]$ acid mostly protonated (hydrogen is there)

$pK_a$ of carboxyl group is ~2

$pK_a$ of amino group is ~9

%%html
<div id="pkaq" style="width: 500px"></div>
<script>
    var divid = "#pkaq";
	jQuery(divid).asker({
	    id: divid,
	    question: "At neutral pH, what is the pronation of the backbone amino and carboxyl groups?",
		answers: ["N-,C-","N+,C-",'N-,C+',"N+,C+"],
        extra: ["both deprotonated","N protonated, C deprotonated","N deprotonated, C protonated","both protonated"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Side Chains Make Different Molecular Interactions

These molecular interactions determine the fold (shape) of the protein and contribute to its function.

• Charge - Charge
• Hydrogen bonding
• Aromaticity
• Hydrophobicity

Charge - Charge

Charge - Charge

Coulomb's Law: the electrostatic force between two point charges is directly proportional to the product of the magnitudes of charges and inversely proportional to the square of the distance between them

Note that the strength of the force depends on the environment: water will shield charges and lessen the force (more later).

These ionic interactions are called salt bridges.

Example: Lamin A

Structural protein of nuclear envelope. Phenotype of R527L is Mandibuloacral dysplasia (premature ageing)

v = py3Dmol.view(query='1ifr',style='cartoon'); sel = {'resi':[527,537]}; v.addStyle(sel,'stick'); v.zoomTo(sel); v.addResLabels(sel); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

%%html
<div id="saltbridge" style="width: 500px"></div>
<script>
    var divid = "#saltbridge";
	jQuery(divid).asker({
	    id: divid,
	    question: "Which pair of amino acids can NOT form a salt bridge?",
		answers: ["R-D","L-D","K-D","R-E"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Polar Groups

Polarization occurs when one of the atoms in a bond withdraws electrons towards (electronegativity) it resulting in partial charges on the atoms.

Polar molecules/groups have polar bonds.

Nonpolar molecules/groups do not have meaningfully polarized bonds (e.g., carbon-carbon).

Polar Hydrogens for Hydrogen Bonds

An electronegative atom (O or N) "shares" a hydrogen with another electronegative atom.

Strength depends on participating atoms, bond geometry (angle and distance), and environment.

Can be reasonably well approximated as purely electrostatic (dipole-dipole), but reality is more complicated.

Hydrogen bonds are ubiquitous and involve the side-chains of polar (charged and uncharged) amino acids as well as the backbone of all amino acids.

Hydrogen Bonds are Directional

From. Introduction to Proteins: Structure, Function, and Motion. Amit Kessel & Nir Ben-Tal

Aromaticity

Flat rings (shared electron system) with unique electronic properties.

Stacking

Rings like to stack flat with a slight offset or in a T-shape.

v = py3Dmol.view(query='6qtl',style='cartoon'); v.addStyle({'resi':[34,104]},'stick'); v.addStyle({'resi':[201]},{'stick':{'colorscheme':'greenCarbon'}}); v.zoomTo({'chain':'D','resi':201}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Cation-Pi Interactions

Image from Proteopedia and Dennis Dougherty.

v = py3Dmol.view(query='2vab',style='cartoon'); sel = {'or':[{'chain':'A','resi':[66,167,170]},{'chain':'P','resi':1}]}; v.addStyle(sel,'stick'); v.zoomTo(sel); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Hydrophobicity

The hydrophobic effect is not a force.

Nonpolar groups don't form favorable interactions with water.

These guys do not want to be solvent exposed and tend to pack in the hydrophobic core of the protein.

hydro = { 'prop': "resn", 'map':  {  'ALA': 'orange',    'ARG': 'white',    'ASN': 'white',    'ASP': 'white',    'CYS': 'orange',    'GLN': 'white',    'GLU': 'white',    'GLY': 'orange',    'HIS': 'white',    'ILE': 'orange',    'LEU': 'orange',    'LYS': 'white',    'MET': 'orange',    'PHE': 'orange',    'PRO': 'white',    'SER': 'white',    'THR': 'white',    'TRP': 'orange',    'TYR': 'orange',    'VAL': 'orange',  }}
v = py3Dmol.view(query='1ubq',style={'stick':{'colorscheme':hydro}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Disulfide Bonds

A covalent bond between the sulfurs (thiol group) of two cysteines (cross-link).

A "molecular staple"

Can act as a redox sensor - disulfid is oxidized fom and unbound is reduced.

v = py3Dmol.view(query='3rnt',style='cartoon'); v.addStyle({'resn':'CYS'},'stick'); v.zoomTo({'resn':'CYS'}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Intramolecular interactions: Dihedrals

• psi ($\psi$): Between backbone carbons
• phi ($\phi$): Between $C_\alpha$ and N
• omega ($\omega$): Between C (NOT $C\alpha$) and N. The peptide bond

Peptide Bond

Due to resonance, peptide bond has strong preference for remaining planar.

Trans is strongly preferred (except proline).

Why is trans preferred?

_{From Introduction to Proteins: Structure, Function, and Motion. Amit Kessel & Nir Ben-Tal}

Ramachandran Plot

As the backbone geometry is largely determined by $\phi$ and $\psi$, can plot their propensities and observe there are clear preferences.

Glycine

Extra flexible and can make tighter turns than other amino acids.

v = py3Dmol.view(query='3ssi',style='cartoon'); v.addStyle({'resn':'GLY'},'sphere'); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Proline

Extra rigid. A "helix-breaker", creates a "kink"

v = py3Dmol.view(query='5cts',style='none'); v.setStyle({'resi':'5-29'},'cartoon'); v.addStyle({'resi':15},'stick'); v.zoomTo({'resi':'5-29'}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Protein Structure

Molecular interactions result in a hierarchy of of structures:

• Primary structure: The sequence
• Secondary structure: The local conformation (helix/sheet/loop)

• Tertiary structure: The complete fold of a single protein chain
• Quaternary structure: The arrangement of multiple chains

Protein Domain

A whole or partial peptide chain that forms an independent structural unit

• well-defined hydrophobic core (usually)
• specific function (usually)
• building block of evolution

Secondary Structure: Alpha Helices

• ~30% of residues in globular proteins
• 3.6 residues per turn
• $2.5\mathrm{\mathring{A}}$ radius
• N-H to C=O hydrogen bond between residues $i$ and $i+4$
• $\phi \approx -60^\circ$
• $\psi \approx -40^\circ$

Secondary Structure: Weird Helices

These are not common (energetically unfavorable) and are usually small and at the start/end of an alpha helix.

$\pi$ helix

• Less tightly wound
• H-bond between $i$ and $i+5$
• 4.4 residues/turn
• $2.8\mathrm{\mathring{A}}$ radius

$3_{10}$ helix

• More tightly wound
• H-bond between $i$ and $i+3$
• 3.0 residues/turn
• $1.9\mathrm{\mathring{A}}$ radius

Secondary Structure: Really Weird Helix

PPII helix

• Poly proline helix
• Left-handed
• No backbone hydrogen bonds
• 3.0 residues/turn
• $1.4\mathrm{\mathring{A}}$ radius
• Common in collagen to form triple helix
• Used in signalling (bind to SH3 domains)

v = py3Dmol.view(query='1cag',style={'cartoon':{'colorscheme':'chain'}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

v = py3Dmol.view(query='1cag',style={'stick':{'colorscheme':'chain'}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Secondary Structure: Beta Strand

• Second most common after alpha helices (~20% of residues in globular proteins)
• Extended backbone
• Alternating side-chains
• $\phi \approx -120^\circ$
• $\psi \approx 120^\circ$
• Form sheets

Beta Sheet: Antiparallel

• Strands run in diffent directions
• Unevenly spaced hydrogen bonds
• Well orient hydrogen bonds - slightly more stable

v = py3Dmol.view(query='1f94',style={'cartoon':{'color':'spectrum','arrows':True},'stick':{}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Beta Sheet: Parallel

• Strands run in the same direction
• Evenly spaced hydrogen bonds
• Slighly less stable than anti-parallel (non-ideal h-bonds)

v = py3Dmol.view(query='1tph',style='none'); v.setStyle({'chain':'1'},{'cartoon':{'color':'spectrum','arrows':True},'stick':{'radius':0.2}}); v.zoomTo({'chain':'1'}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Seconday (Non)Structure

Turns

• Short (~4 residues) connectors of secondary structure (beta sheets)
• Usually an internal hydrogen bond
• Usually contain glycine (why?)
• Different geometries

Loops

• Longer connectors of secondary structure
• Flexible
• Often at the surface and hydrophilic

Structural Motifs

Specific geometric arrangements of secondary structure that occur frequently (and someone has bothered to name)

Helix-Turn-Helix Motif

v = py3Dmol.view(query='1DU0',style='cartoon'); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Coiled-Coil

v = py3Dmol.view(query='1C1G',style={'cartoon':{'colorscheme':'chain'}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Beta Barrel

v = py3Dmol.view(query='1BRP',style={'cartoon':{'color':'spectrum'}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

%%html
<div id="whatdrives" style="width: 500px"></div>
<script>
    var divid = '#whatdrives';
	jQuery(divid).asker({
	    id: divid,
	    question: "What do you think is more responsible for secondary structure formation?",
		answers: ["Hydrogen bonding","Hydrophobicity","Both","Neither"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Next time...

Structure determination

Get checked off on environment setup recitation