Proteins¶

They are kind of important¶

8/30/2022¶

print view

In [1]:
%%html
<script src="https://code.jquery.com/jquery-2.2.4.min.js"></script>
<script src="https://bits.csb.pitt.edu/asker.js/lib/asker.js"></script>
<style>
.reveal pre { font-size: 100%; overflow-x: auto; overflow-y: auto;}
.reveal h1 { font-size: 2em}
.reveal ol {display: block;}
.reveal ul {display: block;}

.jp-OutputArea-output { padding: 0; }
</style>

<script>
$3Dmolpromise = new Promise((resolve, reject) => { 
    require(['https://3Dmol.org/build/3Dmol.js'], function(){       
            resolve();});
});
require(['https://cdnjs.cloudflare.com/ajax/libs/Chart.js/2.2.2/Chart.js'], function(Ch){
 Chart = Ch;
});

$('head').append('<link rel="stylesheet" href="https://bits.csb.pitt.edu/asker.js/themes/asker.default.css" />');


//the callback is provided a canvas object and data 
var chartmaker = function(canvas, labels, data) {
  var ctx = $(canvas).get(0).getContext("2d");
     var dataset = {labels: labels,                     
    datasets:[{
     data: data,
     backgroundColor: "rgba(150,64,150,0.5)",
         fillColor: "rgba(150,64,150,0.8)",    
  }]};
  var myBarChart = new Chart(ctx,{type:'bar',data:dataset,options:{legend: {display:false},
        scales: {
            yAxes: [{
                ticks: {
                    min: 0,
                }
            }]}}});
};

$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

MSCBIO2030: Introduction to Computational Structural Biology¶

...biomolecular structure, statistical mechanical phenomenon in biophysics, simulation of biomolecular behavior, and key applications of computations in the field of structural biology. Specific topics: probability theory, statistical mechanics and thermodynamics, simulation methods, electrostatic phenomena, biochemical kinetics, binding, coarse-grained modeling, enhanced sampling, free energy calculations, protein structure prediction, and structure-based drug design.

Life is basically atoms interacting with one another, so we're going to study that.¶

Instructors¶

Jim Faeder
faeder@pitt.edu
Office: Murdoch 837
Office Hours: 11am Monday

David Koes
dkoes@pitt.edu
Office: Murdoch 748
Office Hours: 11am Friday

TA¶

Ian Dunn
ian.dunn@pitt.edu
Office Hours: 4pm Tuesday

In [2]:
%%html
<div id="dogpref" style="width: 500px"></div>
<script>
    var divid = '#dogpref';
	jQuery(divid).asker({
	    id: divid,
	    question: "How to you feel about dogs?",
		answers: ["Love them","Like them",'Neutral',"Want to avoid"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Logistics¶

  • Lectures 2:30-4:00pm on Tuesdays and Thursdays in Murdoch 814.

  • Building Access Email Kelly Gentille (kmg120@pitt.edu) with picture of front and back of id card.

  • Recitations 12:30-2:30pm on Wednesdays. Average recitation length should be ~1 hour.

  • Course material will be posted to Canvas: https://canvas.pitt.edu/courses/170621

  • Canvas will be used for group discussions, announcements, and contacting staff.

  • Panopto All classes are automatically recorded and are available on Panopto as linked from Canvas. Recordings are provided as a study aid, not a replacement for attending class.

  • Zoom is available as a fallback when in-person attendance is not possible (linked from Canvas). Password is the name of the best dog in the world.

COVID¶

Follow university policy:

  • Mask when Community Level is High
  • Don't come to class sick

Assignments¶

  • Planning on ten assignments
  • A mix of programming (Python) and free response.
  • Students work individually on assignments
    • Do discuss general concepts, strategies for debugging, and the particulars of a specific software package.
    • Do not show your code to fellow classmates.

If you have the assignment due dates for ML, please send them to me and I will try to avoid overlap.

Lateness¶

  • Max two late days per assignment
  • Max five total late days
  • Late assignments have maximum score of 95%
  • Additional late day requests require substantial justification

Books¶

No required books, but several are available for reference.

  • Z: Zuckerman. Statistical Physics of Biomolecules
  • BJD: Bahar, Jernigan, Dill. Protein Actions: Principles & Modeling
  • CELL: Phillips, Kondev, Theriot, Garcia, Orme. Physical Biology of the Cell, 2nd Edition
  • LIFE: Kuriyan, Konforti, Wemmer. The Molecules of Life
  • DILL: Dill, Bromberg. Molecular Driving Forces: Statistical Thermodynamics in Biology, Chemistry, Physics, and Nanoscience
  • KB: Kessel, Ben-tal. Introduction to Proteins: Structure, Function, and Motion
  • FE: Chipot, Pohorille. Free Energy Calculations
  • SIM: Frenkel and Smith. Understanding Molecular Simulation: From Algorithms to Applications
  • PMLS2: Nelson: Physical Models of Living Systems 2nd Edition

Grades¶

  • 80% Assignments
  • 10% Midterm
  • 10% Journal Club and Class Participation

Final Grade Targets¶

  • A+ 97–100%
  • A 93–96%
  • A− 90–92%
  • B+ 87–89%
  • B 83–86%
  • B− 80–82%

We reserve the right to modify grade distributions and cutoffs to most accurately reflect student performance.

Any questions on course mechanics?¶

Central Dogma¶

DNA Sequence $\rightarrow$ RNA $\rightarrow$ Protein $\rightarrow$ Structure (Dynamics) $\rightarrow$ Function

In [3]:
import py3Dmol

DNA Structure¶

Where is major/minor groove?

In [4]:
v = py3Dmol.view('4c64',style='cartoon'); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Molecular Representations¶

Cartoons trace molecule and show key features.

In [5]:
v = py3Dmol.view('4c64',style='cartoon'); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Molecular Representations¶

Spheres (space-filling) highlights individual atoms (usually color coded by element).

In [6]:
v = py3Dmol.view('4c64',style='sphere'); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Molecular Representations¶

Sticks (licorice) highlights bonds. Often used for small molecules.

In [7]:
v = py3Dmol.view('4c64',style='stick'); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Note that sticks and cartoon won't show nonbonded atoms...

In [8]:
v = py3Dmol.view('4c64',style='stick')
v.setStyle({'bonds':0},{'sphere':{'radius':0.5}}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

In [9]:
%%html
<div id="whatdots" style="width: 500px"></div>
<script>
    var divid = '#whatdots';
	jQuery(divid).asker({
	    id: divid,
	    question: "What are the red dots?",
		answers: ["Water","Ions","Cofactors","Phosphates"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Molecular Representations¶

Surfaces show the overall shape.

In [10]:
v = py3Dmol.view('4c64',style='stick')
v.addSurface()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Out[10]:
<py3Dmol.view at 0x1076b7160>

Molecular Surfaces¶

From Introduction to Proteins: Structure, Function, and Motion. Amit Kessel & Nir Ben-Tal

Molecular Surfaces¶

In [11]:
v = py3Dmol.view('4c64',width=770,viewergrid=(1,3))
v.addSurface('VDW',viewer=(0,0)); v.addSurface('MS',viewer=(0,1)); v.addSurface('SAS',viewer=(0,2)); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

RNA Can Have Interesting Structure¶

S-adenosylmethionine (SAM) / S-adenosylhomocysteine (SAH) riboswitch - regulates transcription of SAM-biosynthetic enzymes.

In [12]:
v = py3Dmol.view(query='6HAG',style='cartoon')
v.setStyle({'resn':'SAH'},'sphere')

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Out[12]:
<py3Dmol.view at 0x1076ba580>

RNA Can Have Interesting Structure¶

Transfer RNA

In [13]:
py3Dmol.view(query='4tna',style='stick')

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Out[13]:
<py3Dmol.view at 0x1076ba670>

...But We're Just Going To Focus on Proteins¶

proteins

Proteins are important¶

  • About half of dry mass of a cell
  • Perform most of the cell's functions: transcription, signaling, catalysis, transport, molecular recognition, mechanical support, motion...
In [14]:
v = py3Dmol.view(query='3WTG',style={'cartoon':{'colorscheme':'chain'}})
v.setStyle({'resn':'HEM'},'stick')

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Out[14]:
<py3Dmol.view at 0x1076bae20>

Proteins are polymers (chains) of amino acids¶

GATTACAGATTACAGATTACA $\rightarrow$ (N-terminal) DYRLQIT (C-terminal)

peptidebond

After forming the peptide bond, amino acids are called residues.

You need to know the 20 amino acids¶

amino acids

In [15]:
v = py3Dmol.view(query='cid:5950',style={'stick':{},'sphere':{'radius':0.5}})
v.addLabel('C⍺',{'backgroundOpacity':.8},{'index':3});v.addLabel('N-terminal',{'backgroundOpacity':.8},{'index':10}); v.addLabel('C-terminal',{'backgroundOpacity':.8},{'index':5}); v.addLabel('Side-chain',{'backgroundOpacity':.8},{'index':8}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

In [16]:
%%html
<div id="whataa" style="width: 500px"></div>
<script>
    var divid = '#whataa';
	jQuery(divid).asker({
	    id: divid,
	    question: "What is the previous amino acid?",
		answers: ["alanine","asparigine",'glycine',"None of the above"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

A Bit of Biochemistry¶

Carboxylic acid (carboxyl group)¶

Acidic: wants to lose a proton (hydrogen)

Amino group (primary amine)¶

Basic: wants to gain a proton

pKa¶

Inverse measure of acid strength (lower number = stronger acid)

$$pK_a = -\log(K_a)$$$$K_a = \frac{[R^-][H^+]}{[RH]}$$$$pH = -\log([H^+]) = pK_a + \log\frac{[R^-]}{[RH]}$$

pKa¶

$$pH = pK_a + \log\frac{[R^-]}{[RH]}$$
  • $pH > pK_a \rightarrow [R^-] > [RH]$ acid mostly deprotonated (hydrogen isn't there)
  • $pH < pK_a \rightarrow [R^-] < [RH]$ acid mostly protonated (hydrogen is there)

$pK_a$ of carboxyl group is ~2

$pK_a$ of amino group is ~9

In [17]:
%%html
<div id="pkaq" style="width: 500px"></div>
<script>
    var divid = "#pkaq";
	jQuery(divid).asker({
	    id: divid,
	    question: "At neutral pH, what is the pronation of the backbone amino and carboxyl groups?",
		answers: ["N-,C-","N+,C-",'N-,C+',"N+,C+"],
        extra: ["both deprotonated","N protonated, C deprotonated","N deprotonated, C protonated","both protonated"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Side Chains Make Different Molecular Interactions¶

These molecular interactions determine the fold (shape) of the protein and contribute to its function.

  • Charge - Charge
  • Hydrogen bonding
  • Aromaticity
  • Hydrophobicity

Charge - Charge¶

charged amino acids

Charge - Charge¶

Coulomb's Law: the electrostatic force between two point charges is directly proportional to the product of the magnitudes of charges and inversely proportional to the square of the distance between them

Note that the strength of the force depends on the environment: water will shield charges and lessen the force (more later).

These ionic interactions are called salt bridges.

Example: Lamin A¶

Structural protein of nuclear envelope. Phenotype of R527L is Mandibuloacral dysplasia (premature ageing)

In [18]:
v = py3Dmol.view(query='1ifr',style='cartoon'); sel = {'resi':[527,537]}; v.addStyle(sel,'stick'); v.zoomTo(sel); v.addResLabels(sel); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

In [19]:
%%html
<div id="saltbridge" style="width: 500px"></div>
<script>
    var divid = "#saltbridge";
	jQuery(divid).asker({
	    id: divid,
	    question: "Which pair of amino acids can NOT form a salt bridge?",
		answers: ["R-D","L-D","K-D","R-E"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Polar Groups¶

Polarization occurs when one of the atoms in a bond withdraws electrons towards (electronegativity) it resulting in partial charges on the atoms.

Polar molecules/groups have polar bonds.

Nonpolar molecules/groups do not have meaningfully polarized bonds (e.g., carbon-carbon).

Polar Hydrogens for Hydrogen Bonds¶

An electronegative atom (O or N) "shares" a hydrogen with another electronegative atom.

Strength depends on participating atoms, bond geometry (angle and distance), and environment.

Can be reasonably well approximated as purely electrostatic (dipole-dipole), but reality is more complicated.

polaraa

Hydrogen bonds are ubiquitous and involve the side-chains of polar (charged and uncharged) amino acids as well as the backbone of all amino acids.

ubiq

Hydrogen Bonds are Directional¶

hbonddir

From. Introduction to Proteins: Structure, Function, and Motion. Amit Kessel & Nir Ben-Tal

Aromaticity¶

Flat rings (shared electron system) with unique electronic properties.

aromatics

Stacking¶

Rings like to stack flat with a slight offset or in a T-shape.

In [20]:
v = py3Dmol.view(query='6qtl',style='cartoon'); v.addStyle({'resi':[34,104]},'stick'); v.addStyle({'resi':[201]},{'stick':{'colorscheme':'greenCarbon'}}); v.zoomTo({'chain':'D','resi':201}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Cation-Pi Interactions¶

Image from Proteopedia and Dennis Dougherty.

In [21]:
v = py3Dmol.view(query='2vab',style='cartoon'); sel = {'or':[{'chain':'A','resi':[66,167,170]},{'chain':'P','resi':1}]}; v.addStyle(sel,'stick'); v.zoomTo(sel); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Hydrophobicity¶

The hydrophobic effect is not a force.

Nonpolar groups don't form favorable interactions with water.

These guys do not want to be solvent exposed and tend to pack in the hydrophobic core of the protein.

hydrophobic

In [22]:
hydro = { 'prop': "resn", 'map':  {  'ALA': 'orange',    'ARG': 'white',    'ASN': 'white',    'ASP': 'white',    'CYS': 'orange',    'GLN': 'white',    'GLU': 'white',    'GLY': 'orange',    'HIS': 'white',    'ILE': 'orange',    'LEU': 'orange',    'LYS': 'white',    'MET': 'orange',    'PHE': 'orange',    'PRO': 'white',    'SER': 'white',    'THR': 'white',    'TRP': 'orange',    'TYR': 'orange',    'VAL': 'orange',  }}
v = py3Dmol.view(query='1ubq',style={'stick':{'colorscheme':hydro}}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Disulfide Bonds¶

A covalent bond between the sulfurs (thiol group) of two cysteines (cross-link).

A "molecular staple"

Can act as a redox sensor - disulfid is oxidized fom and unbound is reduced.

In [23]:
v = py3Dmol.view(query='3rnt',style='cartoon'); v.addStyle({'resn':'CYS'},'stick'); v.zoomTo({'resn':'CYS'}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Intramolecular interactions: Dihedrals¶

  • psi ($\psi$): Between backbone carbons
  • phi ($\phi$): Between $C_\alpha$ and N
  • omega ($\omega$): Between C (NOT $C\alpha$) and N. The peptide bond

Peptide Bond¶

Due to resonance, peptide bond has strong preference for remaining planar.

Trans is strongly preferred (except proline).

Why is trans preferred?

peptide

From Introduction to Proteins: Structure, Function, and Motion. Amit Kessel & Nir Ben-Tal

dihedral

Ramachandran Plot¶

As the backbone geometry is largely determined by $\phi$ and $\psi$, can plot their propensities and observe there are clear preferences.

Glycine¶

Extra flexible and can make tigher turns than other amino acids.

In [24]:
v = py3Dmol.view(query='3ssi',style='cartoon'); v.addStyle({'resn':'GLY'},'sphere'); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Proline¶

Extra rigid. A "helix-breaker", creates a "kink"

In [25]:
v = py3Dmol.view(query='5cts',style='none'); v.setStyle({'resi':'5-29'},'cartoon'); v.addStyle({'resi':15},'stick'); v.zoomTo({'resi':'5-29'}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Protein Structure¶

Molecular interactions result in a hierarchy of of structures:

  • Primary structure: The sequence
  • Secondary structure: The local conformation (helix/sheet/loop)

  • Tertiary structure: The complete fold of a single protein chain
  • Quaternary structure: The arrangement of multiple chains

Protein Domain¶

A whole or partial peptide chain that forms an independent structural unit

  • well-defined hydrophobic core (usually)
  • specific function (usually)
  • building block of evolution

Secondary Structure: Alpha Helices¶

  • ~30% of residues in globular proteins
  • 3.6 residues per turn
  • $2.5\mathrm{\mathring{A}}$ radius
  • N-H to C=O hydrogen bond between residues $i$ and $i+4$
  • $\phi \approx -60^\circ$
  • $\psi \approx -40^\circ$

Secondary Structure: Weird Helices¶

These are not common (energetically unfavorable) and are usually small and at the start/end of an alpha helix.

$\pi$ helix¶

  • Less tightly wound
  • H-bond between $i$ and $i+5$
  • 4.4 residues/turn
  • $2.8\mathrm{\mathring{A}}$ radius

$3_{10}$ helix¶

  • More tightly wound
  • H-bond between $i$ and $i+3$
  • 3.0 residues/turn
  • $1.9\mathrm{\mathring{A}}$ radius

Secondary Structure: Really Weird Helix¶

PPII helix¶

  • Poly proline helix
  • Left-handed
  • No backbone hydrogen bonds
  • 3.0 residues/turn
  • $1.4\mathrm{\mathring{A}}$ radius
  • Common in collagen to form triple helix
  • Used in signalling (bind to SH3 domains)
In [26]:
v = py3Dmol.view(query='1cag',style={'cartoon':{'colorscheme':'chain'}}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Secondary Structure: Beta Strand¶

  • Second most common after alpha helices (~20% of residues in globular proteins)
  • Extended backbone
  • Alternating side-chains
  • $\phi \approx -120^\circ$
  • $\psi \approx 120^\circ$
  • Form sheets

Beta Sheet: Antiparallel¶

  • Strands run in diffent directions
  • Unevenly spaced hydrogen bonds
  • Well orient hydrogen bonds
In [27]:
v = py3Dmol.view(query='1f94',style={'cartoon':{'color':'spectrum','arrows':True},'stick':{}}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Beta Sheet: Parallel¶

  • Strands run in the same direction
  • Evenly spaced hydrogen bonds
  • Slighly less stable than anti-parallel (non-ideal h-bonds)
In [28]:
v = py3Dmol.view(query='1tph',style='none'); v.setStyle({'chain':'1'},{'cartoon':{'color':'spectrum','arrows':True},'stick':{}}); v.zoomTo({'chain':'1'}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Seconday (Non)Structure¶

Turns¶

  • Short (~4 residues) connectors of secondary structure (beta sheets)
  • Usually an internal hydrogen bond
  • Usually contain glycine (why?)
  • Different geometries

Loops¶

  • Longer connectors of secondary structure
  • Flexible
  • Often at the surface and hydrophilic

Structural Motifs¶

Specific geometric arrangements of secondary structure that occur frequently (and someone has bothered to name)

Helix-Turn-Helix Motif¶

In [29]:
v = py3Dmol.view(query='1DU0',style='cartoon'); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Coiled-Coil¶

In [30]:
v = py3Dmol.view(query='1C1G',style={'cartoon':{'colorscheme':'chain'}}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

Beta Barrel¶

In [31]:
v = py3Dmol.view(query='1BRP',style={'cartoon':{'color':'spectrum'}}); v.show()

You appear to be running in JupyterLab (or JavaScript failed to load for some other reason). You need to install the 3dmol extension:
jupyter labextension install jupyterlab_3dmol

In [33]:
%%html
<div id="whatdrives" style="width: 500px"></div>
<script>
    var divid = '#whatdrives';
	jQuery(divid).asker({
	    id: divid,
	    question: "What do you think is more responsible for secondary structure formation?",
		answers: ["Hydrogen bonding","Hydrophobicity","Both","Neither"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Next time...¶

Structure determination

Recitation tomorrow¶