Proteins¶

They are kind of important¶

8/26/2026¶

print view

In [38]:
%%html
<script src="https://bits.csb.pitt.edu/preamble.js"></script>

Central Dogma¶

DNA Sequence $\rightarrow$ RNA $\rightarrow$ Protein $\rightarrow$ Structure (Dynamics) $\rightarrow$ Function

In [39]:
import py3Dmol

...But We're Just Going To Focus on Proteins¶

No description has been provided for this image

Proteins are important¶

  • About half of dry mass of a cell
  • Perform most of the cell's functions: transcription, signaling, catalysis, transport, molecular recognition, mechanical support, motion...
In [40]:
v = py3Dmol.view(query='3WTG',style={'cartoon':{'colorscheme':'chain'}},height=400)
v.setStyle({'resn':'HEM'},'stick').show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Proteins are Drug Targets¶

No description has been provided for this image

Santos R, Ursu O, Gaulton A, Bento AP, Donadi RS, Bologa CG, Karlsson A, Al-Lazikani B, Hersey A, Oprea TI, Overington JP. A comprehensive map of molecular drug targets. Nature reviews Drug discovery. 2017 Jan;16(1):19-34.

Proteins are polymers (chains) of amino acids¶

GATTACAGATTACAGATTACA $\rightarrow$ (N-terminal) DYRLQIT (C-terminal)

peptidebond

After forming the peptide bond, amino acids are called residues.

You need to know the 20 amino acids¶

amino acids

In [41]:
v = py3Dmol.view(query='cid:5950',style={'stick':{},'sphere':{'radius':0.5}})
v.addLabel('C⍺',{'backgroundOpacity':.8},{'index':3});v.addLabel('N-terminal',{'backgroundOpacity':.8},{'index':10}); v.addLabel('C-terminal',{'backgroundOpacity':.8},{'index':5}); v.addLabel('Side-chain',{'backgroundOpacity':.8},{'index':8}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

In [42]:
%%html
<div id="whataa" style="width: 500px"></div>
<script>
    var divid = '#whataa';
	jQuery(divid).asker({
	    id: divid,
	    question: "What is the previous amino acid?",
		answers: ["alanine","asparigine",'glycine',"None of the above"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

A Bit of Biochemistry¶

Carboxylic acid (carboxyl group)¶

Acidic: wants to lose a proton (hydrogen) No description has been provided for this image

Amino group (primary amine)¶

Basic: wants to gain a proton No description has been provided for this image

pKa¶

Inverse measure of acid strength (lower number = stronger acid; opposite of Ka, the acid dissassociation constant)

$$pK_a = -\log(K_a)$$

$$K_a = \frac{[R^-][H^+]}{[RH]}$$

$$pH = -\log([H^+]) = pK_a + \log\frac{[R^-]}{[RH]}$$

pKa¶

No description has been provided for this image $$pH = pK_a + \log\frac{[R^-]}{[RH]}$$
  • $pH > pK_a \rightarrow [R^-] > [RH]$ acid mostly deprotonated (hydrogen isn't there)
  • $pH < pK_a \rightarrow [R^-] < [RH]$ acid mostly protonated (hydrogen is there)

$pK_a$ of carboxyl group is ~2

$pK_a$ of amino group is ~9

In [43]:
%%html
<div id="pkaq" style="width: 500px"></div>
<script>
    var divid = "#pkaq";
	jQuery(divid).asker({
	    id: divid,
	    question: "At neutral pH, what is the pronation of the backbone amino and carboxyl groups?",
		answers: ["N-,C-","N+,C-",'N-,C+',"N+,C+"],
        extra: ["both deprotonated","N protonated, C deprotonated","N deprotonated, C protonated","both protonated"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>
In [44]:
%%html
<div id="histsense" style="width: 500px"></div>
<script>
    var divid = "#histsense";
	jQuery(divid).asker({
	    id: divid,
	    question: "Which amino acid residue is best at acting as a pH sensor?",
        answers: ["glutamic acid","lysine","histidine","tryptophan"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Side Chains Make Different Molecular Interactions¶

These molecular interactions determine the fold (shape) of the protein and contribute to its function.

  • Charge - Charge
  • Hydrogen bonding
  • Aromaticity
  • Hydrophobicity

Charge - Charge¶

charged amino acids

Charge - Charge¶

Coulomb's Law: the electrostatic force between two point charges is directly proportional to the product of the magnitudes of charges and inversely proportional to the square of the distance between them

No description has been provided for this image

Note that the strength of the force depends on the environment: water will shield charges and lessen the force (more later).

These ionic interactions are called salt bridges.

In [46]:
%%html
<div id="saltbridge" style="width: 500px"></div>
<script>
    var divid = "#saltbridge";
	jQuery(divid).asker({
	    id: divid,
	    question: "Which pair of amino acids can NOT form a salt bridge?",
		answers: ["R-D","L-D","K-D","R-E"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Example: Lamin A¶

Structural protein of nuclear envelope. Phenotype of R527L is Mandibuloacral dysplasia (premature ageing)

In [45]:
v = py3Dmol.view(query='1ifr',style='cartoon'); sel = {'resi':[527,537]}; v.addStyle(sel,'stick'); v.zoomTo(sel); v.addResLabels(sel); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Polar Groups¶

No description has been provided for this image

Polarization occurs when one of the atoms in a bond withdraws electrons towards (electronegativity) it resulting in partial charges on the atoms.

Polar molecules/groups have polar bonds.

Nonpolar molecules/groups do not have meaningfully polarized bonds (e.g., carbon-carbon).

Polar Hydrogens for Hydrogen Bonds¶

No description has been provided for this image

An electronegative atom (O or N) "shares" a hydrogen with another electronegative atom.

Strength depends on participating atoms, bond geometry (angle and distance), and environment.

Can be reasonably well approximated as purely electrostatic (dipole-dipole), but reality is more complicated.

polaraa

Hydrogen bonds are ubiquitous and involve the side-chains of polar (charged and uncharged) amino acids as well as the backbone of all amino acids.

No description has been provided for this image

Hydrogen Bonds are Directional¶

hbonddir

From. Introduction to Proteins: Structure, Function, and Motion. Amit Kessel & Nir Ben-Tal

Aromaticity¶

Flat rings (shared electron system) with unique electronic properties. No description has been provided for this image

aromatics

Stacking¶

Rings like to stack flat with a slight offset or in a T-shape.

No description has been provided for this imageNo description has been provided for this image

In [15]:
v = py3Dmol.view(query='6qtl',style='cartoon'); v.addStyle({'resi':[34,104]},'stick'); v.addStyle({'resi':[201]},{'stick':{'colorscheme':'greenCarbon'}}); v.zoomTo({'chain':'D','resi':201}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

A nanobody homodimer binding to my favorite molecule...

Cation-Pi Interactions¶

No description has been provided for this image

Image from Proteopedia and Dennis Dougherty.

In [50]:
v = py3Dmol.view(query='2vab',style='cartoon'); sel = {'or':[{'chain':'A','resi':[66,167,170]},{'chain':'P','resi':1}]}; v.setStyle({'chain':'A'},{'cartoon':{'colorscheme':'greenCarbon'}}); v.setStyle({'chain':'P'},{'cartoon':{'colorscheme':'cyanCarbon'}}); v.addStyle(sel,'stick'); v.zoomTo(sel); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

An MHC protein holding a small viral peptide so it can be displayed to T cells for immune recognition.

Hydrophobicity¶

No description has been provided for this image

The hydrophobic effect is not a force.

Nonpolar groups don't form favorable interactions with water.

These guys do not want to be solvent exposed and tend to pack in the hydrophobic core of the protein.

hydrophobic

In [51]:
hydro = { 'prop': "resn", 'map':  {  'ALA': 'orange',    'ARG': 'white',    'ASN': 'white',    'ASP': 'white',    'CYS': 'orange',    'GLN': 'white',    'GLU': 'white',    'GLY': 'orange',    'HIS': 'white',    'ILE': 'orange',    'LEU': 'orange',    'LYS': 'white',    'MET': 'orange',    'PHE': 'orange',    'PRO': 'white',    'SER': 'white',    'THR': 'white',    'TRP': 'orange',    'TYR': 'orange',    'VAL': 'orange',  }}
v = py3Dmol.view(query='1ubq',style={'stick':{'colorscheme':hydro}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Disulfide Bonds¶

No description has been provided for this image

A covalent bond between the sulfurs (thiol group) of two cysteines (cross-link).

A "molecular staple"

Can act as a redox sensor - disulfid is oxidized fom and unbound is reduced.

In [23]:
v = py3Dmol.view(query='3rnt',style='cartoon'); v.addStyle({'resn':'CYS'},'stick'); v.zoomTo({'resn':'CYS'}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

An RNA-cutting enzyme poised for catalysis.

Intramolecular interactions: Dihedrals¶

No description has been provided for this image
  • psi ($\psi$): Between backbone carbons
  • phi ($\phi$): Between $C_\alpha$ and N
  • omega ($\omega$): Between C (NOT $C\alpha$) and N. The peptide bond

Peptide Bond¶

Due to resonance, peptide bond has strong preference for remaining planar.

Trans is strongly preferred (except proline).

No description has been provided for this image

Why is trans preferred?

peptide

From Introduction to Proteins: Structure, Function, and Motion. Amit Kessel & Nir Ben-Tal

dihedral

Ramachandran Plot¶

As the backbone geometry is largely determined by $\phi$ and $\psi$, can plot their propensities and observe there are clear preferences.

No description has been provided for this image

Glycine¶

No description has been provided for this image

Extra flexible and can make tighter turns than other amino acids.

No description has been provided for this image
In [24]:
v = py3Dmol.view(query='3ssi',style='cartoon'); v.addStyle({'resn':'GLY'},'sphere'); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Proline¶

Extra rigid. A "helix-breaker", creates a "kink" No description has been provided for this image

No description has been provided for this image
In [26]:
v = py3Dmol.view(query='5cts',style='none'); v.setStyle({'resi':'5-29'},'cartoon'); v.addStyle({'resi':15},'stick'); v.zoomTo({'resi':'5-29'}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Protein Structure¶

Molecular interactions result in a hierarchy of of structures:

  • Primary structure: The sequence
  • Secondary structure: The local conformation (helix/sheet/loop)

  • Tertiary structure: The complete fold of a single protein chain
  • Quaternary structure: The arrangement of multiple chains

Protein Domain¶

No description has been provided for this image

A whole or partial peptide chain that forms an independent structural unit

  • well-defined hydrophobic core (usually)
  • specific function (usually)
  • building block of evolution

Secondary Structure: Alpha Helices¶

No description has been provided for this image
  • ~30% of residues in globular proteins
  • 3.6 residues per turn
  • $2.5\mathrm{\mathring{A}}$ radius
  • N-H to C=O hydrogen bond between residues $i$ and $i+4$
  • $\phi \approx -60^\circ$
  • $\psi \approx -40^\circ$

Secondary Structure: Weird Helices¶

No description has been provided for this image

These are not common (energetically unfavorable) and are usually small and at the start/end of an alpha helix.

$\pi$ helix¶

  • Less tightly wound
  • H-bond between $i$ and $i+5$
  • 4.4 residues/turn
  • $2.8\mathrm{\mathring{A}}$ radius

$3_{10}$ helix¶

  • More tightly wound
  • H-bond between $i$ and $i+3$
  • 3.0 residues/turn
  • $1.9\mathrm{\mathring{A}}$ radius

Secondary Structure: Really Weird Helix¶

No description has been provided for this image

PPII helix¶

  • Poly proline helix
  • Left-handed
  • No backbone hydrogen bonds
  • 3.0 residues/turn
  • $1.4\mathrm{\mathring{A}}$ radius
  • Common in collagen to form triple helix
  • Used in signalling (bind to SH3 domains)
In [27]:
v = py3Dmol.view(query='1cag',style={'cartoon':{'colorscheme':'chain'}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

In [30]:
v = py3Dmol.view(query='1cag',style={'stick':{'colorscheme':'chain'}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Secondary Structure: Beta Strand¶

  • Second most common after alpha helices (~20% of residues in globular proteins)
  • Extended backbone
  • Alternating side-chains
  • $\phi \approx -120^\circ$
  • $\psi \approx 120^\circ$
  • Form sheets
No description has been provided for this image

Beta Sheet: Antiparallel¶

No description has been provided for this image
  • Strands run in diffent directions
  • Unevenly spaced hydrogen bonds
  • Well orient hydrogen bonds - slightly more stable
In [31]:
v = py3Dmol.view(query='1f94',style={'cartoon':{'color':'spectrum','arrows':True},'stick':{}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

A small bacterial protein whose job is to bind and shut down protein-cutting enzymes.

Beta Sheet: Parallel¶

No description has been provided for this image
  • Strands run in the same direction
  • Evenly spaced hydrogen bonds
  • Slighly less stable than anti-parallel (non-ideal h-bonds)
In [37]:
v = py3Dmol.view(query='1tph',style='none'); v.setStyle({'chain':'1'},{'cartoon':{'color':'spectrum','arrows':True},'stick':{'radius':0.2}}); v.zoomTo({'chain':'1'}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Seconday (Non)Structure¶

Turns¶

  • Short (~4 residues) connectors of secondary structure (beta sheets)
  • Usually an internal hydrogen bond
  • Usually contain glycine (why?)
  • Different geometries

Loops¶

  • Longer connectors of secondary structure
  • Flexible
  • Often at the surface and hydrophilic

Structural Motifs¶

Specific geometric arrangements of secondary structure that occur frequently (and someone has bothered to name)

Helix-Turn-Helix Motif¶

In [33]:
v = py3Dmol.view(query='1DU0',style='cartoon'); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Common DNA binding motif.

Coiled-Coil¶

In [52]:
v = py3Dmol.view(query='1C1G',style={'cartoon':{'colorscheme':'chain'}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

Beta Barrel¶

In [53]:
v = py3Dmol.view(query='1BRP',style={'cartoon':{'color':'spectrum'}}); v.show()

3Dmol.js failed to load for some reason. Please check your browser console for error messages.

In [54]:
%%html
<div id="whatdrives" style="width: 500px"></div>
<script>
    var divid = '#whatdrives';
	jQuery(divid).asker({
	    id: divid,
	    question: "What do you think is more responsible for secondary structure formation?",
		answers: ["Hydrogen bonding","Hydrophobicity","Both","Neither"],
        server: "https://bits.csb.pitt.edu/asker.js/example/asker.cgi",
		charter: chartmaker})
    
$(".jp-InputArea .o:contains(html)").closest('.jp-InputArea').hide();


</script>

Next time...¶

Structure determination